The function of Ran in the immune system was investigated using Ran transgenic (Tg) mice
The function of Ran in the immune system was investigated using Ran transgenic (Tg) mice. for selective transcription factors such as c-Jun and c-Fos of AP-1, which is known to be crucial in T cell activation and proliferation and lymphokine secretion. Keywords:Cell/Differentiation, Gene, Gene/Regulation, Immunology/T cell Receptor, Protein/Binding/DNA, Protein/Translocation, Receptors/Cytokine == Introduction == Ras-related nuclear protein (Ran)3GTPase Pralatrexate was first Pralatrexate identified as a member of Ras family guanine nucleotide-binding proteins in 1990 from teratocarcinoma cells (1). It is a rather abundant 25-kDa protein, about 80% of which is located in the nucleus (2). Ran is a highly conserved gene from yeast to mammals (1,3). It forms a complex with RCC1 (regulator of chromosomal condensation) (4), and the complex performs critical functions in many cellular events, such as DNA replication (5), cell cycle progression (5), nuclear structure (6,7), RNA processing and exportation (8), and nuclear protein importation (9). In the mouse genome, Ran resides in chromosome 5 (GenBankTMaccession numberNM_009391). Multiple Ran isoform genes are located in different genomic loci in mice (10). An actively transcribed isoform, Ran/M2, is usually coded by a gene in chromosome 7 (GenBank accession number:NM_009028); Ran and Ran/M2 share 94.6% identity in the nucleotide coding sequence and 94.0% identity and 98.1% similarity (allowing amino acid substitution) in their peptide sequences (11). It is likely that multiple isoforms are the result of gene duplication during evolution. Ran is expressed in various tissues, whereas Ran/M2 has restricted expression in the testis according to real-time reverse transcription-PCR (RT-PCR) analysis (11). The functions of Ran in the immune system have been reported in a few articles (1214). Cells overexpressing Ran byin vitrotransfection seem to gain the ability of T cell costimulation. For example, COS cells transfected with Ran can costimulate mouse CD8 but not CD4 cells; RMA lymphoma cells transfected with Ran become less tumorigenicin vivo(12). Consistent with the role of Ran in protein importation into nuclei, IFN–dependent STAT-1 translocation to nuclei depends on Ran and its GTPase activity (13). In this study, we mapped the expression pattern of Ran during ontogeny. We generated transgenic mice overexpressing Ran using an actin promoter. Ran transgenic (Tg) T cells presented compromised functions and reduced c-Jun and c-Fos Pralatrexate nuclear import upon activation. Our results suggest that the Ran expression level controls the nuclear presence of selective transcription factors, which in turn modulate T cell immune responses. == MATERIALS AND METHODS == == == == == == In Situ Hybridization (ISH) == The 1091-bp full-length Ran cDNA in pCMV-SPORT6 (clone MGC-18932 from the American Type Culture Collection, Manassas, VA) was employed to generate sense and antisense riboprobes using SP6 HDAC3 and T7 RNA polymerase for both [35S]UTP and [35S]CTP incorporation, as described elsewhere (14). Tissues were frozen in 35 C isopentane and kept at 80 C until cut. ISH was performed on 10-m cryostat sections, as layed out previously (15). Anatomic ISH was conducted with x-ray films. ISH microscopy was obtained by photographic emulsion followed by 8-day exposure. The slides were developed and then counterstained with hematoxylin. == Generation of Ran Tg Mice == Mouse full-length Ran cDNA (MGC-18932) was excised from the vector Pralatrexate with SmaI/Xba, and cloned into the BamHI (blunted)/XbaI sites in vector pAC between the human -actin promoter and -actin poly(A) signals. The resulting construct was named pAC-Ran. The 4.9-kb ClaI/ClaI fragment containing the -actin promoter, Ran cDNA, and -actin poly(A) signal was excised and injected into fertilized C3H C57BL/6 eggs. Genotyping of the Tg mice was first performed by Southern blot analysis. Tail DNA of the founders (10 g/each) was digested with PstI and resolved by 1% agarose gel electrophoresis. The DNA was transferred onto N+Hybond nylon membranes after denaturation. A 559-bp NotI/SalI fragment from Ran/M2 cDNA (clone H2101F02, NIA, National Institutes of Health, mouse 15,000 cDNA clone set; positions 4161075, according to the sequence in GenBank, accession numberNM_009028) was labeled with digoxin by a digoxin labeling kit from Roche Applied Sciences (Laval, QC, Canada). The membranes were hybridized with digoxin-labeled probes, and the signals were revealed by a digoxin detection kit (Roche Applied Sciences). A 2.38-kb band specific to the transgene was detected. PCRs were conducted for subsequent genotyping. The 5 and 3 primers were GAGGTTGCTCAGACGACTGCT (derived from Ran/M2 cDNA with 90.4% homology to the Ran cDNA) and GAATGCAATTGTTGGTAACTTG (derived from a sequence downstream of the insert in the plasmid construct), respectively, to detect a 529-bp band. The following PCR conditions were.