Similarities in PUM1/2 activities might be explained by their highly conserved amino-acid sequences (83% similarity), with 91% homology in their RNA-binding domains

Similarities in PUM1/2 activities might be explained by their highly conserved amino-acid sequences (83% similarity), with 91% homology in their RNA-binding domains.18 Unexpectedly, overexpression of PUM1/2 was similarly deleterious for HSPC and leukemic cell survival (data not shown), probably reflecting PUM major contribution to chromosome instability, as recently reported.27,28 These observations indicate that PUM levels are subjected to fine-tuning to control myeloid cell growth. PUM factors are ubiquitously expressed. colony-stimulating factor (2.5 ng/mL). Murine HPC-7 cells were cultured as described.20 Clonogenic potential was evaluated according to manufacturers recommendations (MethoCult H4230, MethoCult M3234; StemCell Technologies, Vancouver, BC, Canada). Constructions and lentiviral transduction are detailed in supplemental data. In vivo hematopoietic reconstitution assays Human HSPCs. NOD-SCID/IL2Rc?/? immunodeficient mice (NSG; originally from the Jackson Laboratory, Bar Harbor, ME) (8-12 weeks old) were bred at Commissariat lEnergie Atomique animal facility (Fontenay-aux-Roses, Paris, France). Three-gray-irradiated NSG mice were transplanted using intrafemur route with a mixture of 7 104 shPUM-Tomato-vector-transduced CD34+ cells and 7 104 shCtrl-GFP-vector transduced CD34+ cells. Hematopoietic reconstitution was assessed 12 weeks after transplantation by labeling TRAIL-R2 BM cells with human CD45 antibody. Percentages of Tomato+/shPUM- or GFP+/shCtrl-CD45+ cells were determined by flow cytometry. Mice were considered positive when at least 0.5% of human cells were detected in mouse BM. Murine HSPCs. C57BL/6-Ly5.2, C57Bl/6-Ly5.1 mice (8-14 weeks old) Micafungin Sodium were purchased from Charles River (lArbresle, France), maintained at Cochin Institute facility (Paris, France) under pathogen-free conditions, and used for experiments according to guidelines from the Ethical Committee of the French Agriculture Department. C57Bl/6 (Ly5.2) mice were used as recipients, whereas LSKCD150+ cells were prepared from C57Bl/6 (Ly5.1) donors. Lethally irradiated recipients (9.5 Gy) were injected intravenously with 15?000 untransduced and transduced Ly5.1 cells (1:1), together with 1.5 105 Ly5.2 BM cells. Hematopoietic reconstitution was assessed 4 months after transplantation through quantification of GFP expression of CD45.1-phycoerythrin (PE)-labeled cells by flow cytometry. Cell cycle, cell viability Cell cycle was examined by propidium iodide labeling (Life Technologies) following manufacturers instructions using flow cytometry (AccuriC6; Becton Dickinson) and FlowJo software. Cell viability was assessed using PE-conjugated Annexin V labeling detection kit (BD Pharmingen). Immunoprecipitation and western blot analysis Cells were lysed at 4C with lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, Micafungin Sodium 1 mM EDTA, 0.5% NP-40, 0.25% sodium deoxycholate, 10% glycerol) supplemented with protease inhibitor cocktail (Roche). Immunoprecipitation (IP) was performed with 500 g proteins and 5 g of the indicated antibody. Immunoprecipitates or 20 to 50 g of whole cell lysates were loaded on sodium dodecyl sulfateCpolyacrylamide gel electrophoresis gels and transferred onto nitrocellulose membranes (Amersham Biosciences). Detection was performed using enhanced chemiluminescence (Amersham Biosciences). Images were captured using a CCD camera (Fuji-LAS4000; Fujifilm, Tokyo, Japan). The antibodies are listed in supplemental Table 2. Stable isotope labeling with amino acids in cell-based quantitative proteomic approach is detailed in supplemental data. Luciferase assays MOLM-14 cells (106) were transfected with 300 pmol of siPUM1 (SR306467B; OriGene), siPUM2 (SR308223C; OriGene), or scrambled control small interfering RNA (siRNA) (SR30004; OriGene) using Lipofectamine 2000. After 24 hours, cells were transfected with 300 ng of psiCHECK-2 constructs by Nucleofection with Amaxa Cell Line Nucleofector Kit V (programT-003; Lonza). Twenty-four hours later, luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega). Oligoribonucleotide pull-down assays Streptavidin magnetic beads (Pierce) were presaturated overnight at 4C with 50 g/mL yeast transfer RNA (tRNA; Life Technologies) and 0.1 mg/mL RNase-free BSA (Ambion) in lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 5% glycerol) and then washed. Cells were lysed in lysis buffer supplemented with protease and phosphatase inhibitors, 30 g/mL tRNA and 400 U/mL RNaseOUT (Life Technologies). Lysates were subjected to 1 round of preclearing for 30 minutes at 4C with streptavidin beads, before incubation with 50 pmol of the indicated biotin-labeled FOXP1-RNA probe wild-type (WT)1 (UAUUACGUUGUACAUAUAUCCCGAU) or MUT1 (UAUUACGUUCCCGUUAUAUCCCGAU) and 250 pmol of the indicated FOXP1-RNA competitor: WT1 (UACGUUGUACAUAUAUCC), MUT1 (UACGUUCCCGUUAUAUCC), WT2 (AAGGCUUAUGUACAUACGUGAAGAG), Micafungin Sodium or MUT2 (AAGGCUUAUCCCGUUACGUGAAGAG) in RNA-binding buffer (10 mM HEPES [and/or and/or expression and analyzed using Ct method. Statistical analysis All analyses were performed using GraphPad Prism software. Data are presented as the mean standard error of the mean (SEM). When distribution was normal (assessed with a Shapiro-Wilk test), the 2-tailed Student test was used for group comparisons. In the other cases, the Mann-Whitney test was used. The Pearson coefficient was calculated to determine the correlation between the normally distributed mRNA and mRNA expressions in acute myeloid leukemia (AML). Statistics were carried out on a minimum of 3 independent experiments. Results PUM1 and.